SubtiBank SubtiBank
yokE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yokE

unknown
locus
BSU_21620
pI
10.04
mw
18.11 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,280,881 → 2,281,363

    Expression and Regulation

    Operons

    genes
    [gene|27F32FB0F96276325ED93710DF77B949658D728D|yokF]-[gene|C4C5A7CCD4B02EC846A40C52574A1092D5A95F68|yokE]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE21620 (Δ[gene|C4C5A7CCD4B02EC846A40C52574A1092D5A95F68|yokE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTTATCTCCTTTCAT, downstream forward: _UP4_TAAAAAGCCCGTTTTTGGGC
  • BKK21620 (Δ[gene|C4C5A7CCD4B02EC846A40C52574A1092D5A95F68|yokE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTTATCTCCTTTCAT, downstream forward: _UP4_TAAAAAGCCCGTTTTTGGGC