SubtiBank SubtiBank
opuBC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

opuBC

choline and arsenocholine [SW|ABC transporter] (binding protein)
locus
BSU33710
pI
6.62
mw
34.25 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast
function
compatible solute transport
product
choline and arsenocholine [SW|ABC transporter] (binding protein)
essential
no
synonyms
proX

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.4|Uptake of compatible solutes for osmoprotection]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,460,503 → 3,461,423

    The protein

    Catalyzed reaction/ biological activity

  • uptake of choline and arsenocholine [pubmed|29159878]
  • Paralogous protein(s)

  • [protein|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|OpuCC]
  • Structure

  • [PDB|3R6U], [PDB|6EYQ] (in complex with choline) [pubmed|21658392]
  • [PDB|5NXX] (in complex with arsenocholine) [pubmed|29159878]
  • [PDB|6EYL] (in complex with carnitine)
  • [PDB|6EYG] (mutant in complex with betaine)
  • [PDB|6EYH] (mutant in complex with dimethylsulfoniopropionate)
  • [SW|Localization]

  • associated to the membrane (via [protein|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|OpuBB]-[protein|1532EC3D741C5AB3D0B642741218FAE00AD460FA|OpuBD]) [Pubmed|10092453]
  • lipoprotein [Pubmed|10216873]
  • Expression and Regulation

    Operons

    genes
    [gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD]
    description
    [Pubmed|10216873]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10216873], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR]: repression, [Pubmed|22408163], in [regulon|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR regulon]
  • [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR]: repression, [Pubmed|23960087], in [regulon|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR regulon]
  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • regulation

  • induced by choline ([protein|search|GbsR]) [Pubmed|22408163]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for'[protein|search|opuBD]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE33710 (Δ[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTCTTTTCATGAGCCGCC, downstream forward: _UP4_GAATCGTGAAAGGGGGAAGA
  • BKK33710 (Δ[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTCTTTTCATGAGCCGCC, downstream forward: _UP4_GAATCGTGAAAGGGGGAAGA
  • References

    Reviews

  • 27935846
  • Original publications

  • 22408163,21366542,21658392,10092453,9925583,10216873,21296969,23960087,23646920,28256787,29159878