opuBC

choline and arsenocholine ABC transporter (binding protein)

Locus: BSU_33710

Isoelectric point: 6.62

Molecular weight: 34.25 kDa

Protein length: 306 aa

Gene length: 921 bp

Function: compatible solute transport

Product: choline and arsenocholine ABC transporter (binding protein)

Essential: no

Synonyms: proX

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of compatible solutes for osmoprotection
• Lifestyles → Coping with stress → Coping with hyper-osmotic stress
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,460,503 → 3,461,423

The protein

Catalyzed reaction/ biological activity

• uptake of choline and arsenocholine PubMed

Protein family

• OsmX family (with OpuCC, according to UniProt)

Paralogous protein(s)

• OpuCC

Structure

• 3R6U, 6EYQ (in complex with choline) PubMed
• 5NXX (in complex with arsenocholine) PubMed
• 6EYL (in complex with carnitine)
• 6EYG (mutant in complex with betaine)
• 6EYH (mutant in complex with dimethylsulfoniopropionate)

Localization

• associated to the membrane (via OpuBB-OpuBD) PubMed
• lipoprotein PubMed

Expression and Regulation

Operons

• Genes: opuBA-opuBB-opuBC-opuBD
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • GbsR: repression, (transcriptional roadblock) PubMed, in GbsR regulon
  • OpcR: repression, (sterical interference with RNA polymerase access) PubMed, in OpcR regulon
  • RemA: activation, PubMed, in RemA regulon

  Regulation

  • induced by choline (GbsR) PubMed
  • expression increases with increasing salinity PubMed

  Additional information

  • S1290 acts as antisense RNA for the opuBA-opuBB-opuBC-opuBD operon PubMed
  • expression starts with a delay after osmotic upshift due to transcriptional interference of RNA polymerase complexes driving synthesis of the converging opuB and S1290 mRNAs PubMed

Biological materials

Mutant

• BKE33710 (ΔopuBC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TTTTCTTTTCATGAGCCGCC, downstream forward: _UP4_GAATCGTGAAAGGGGGAAGA
• BKK33710 (ΔopuBC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TTTTCTTTTCATGAGCCGCC, downstream forward: _UP4_GAATCGTGAAAGGGGGAAGA

References

Reviews

Loading

Original publications

Loading