SubtiBank SubtiBank
hepS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hepS

heptaprenyl diphosphate synthase component I
locus
BSU_22760
pI
6.27
mw
28.97 kDa
protein length
251 aa Sequence Blast
gene length
756 bp Sequence Blast
function
menaquinone biosynthesis
product
heptaprenyl diphosphate synthase component I (together with [protein|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|HepT])
essential
no
ec
2.5.1.30
synonyms
gerCA,hepA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.8|Biosynthesis of menaquinone]
  • Gene

    Coordinates
    2,383,615 → 2,384,370

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • (2E,6E)-farnesyl diphosphate + 4 isopentenyl diphosphate --> all-trans-heptaprenyl diphosphate + 4 diphosphate (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C45A5935559F0DAAD70F808725AF730BC18A2B0A|hepS]-[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]-[gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]-[gene|B498ED03F19B7A73878D5C947C28C2A87CAB934D|ndk]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE22760 (Δ[gene|C45A5935559F0DAAD70F808725AF730BC18A2B0A|hepS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAATATCACCCTTGTCC, downstream forward: _UP4_TAAACCATTATGCAGGACTC
  • BKK22760 (Δ[gene|C45A5935559F0DAAD70F808725AF730BC18A2B0A|hepS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAATATCACCCTTGTCC, downstream forward: _UP4_TAAACCATTATGCAGGACTC
  • References

  • 23840410,28189581