SubtiBank SubtiBank
dgcK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

dgcK

diguanylate cyclase
locus
BSU_09120
pI
8.57
mw
40.53 kDa
protein length
359 aa Sequence Blast
gene length
1080 bp Sequence Blast
function
synthesis of c-di-GMP
product
diguanylate cyclase
essential
no
synonyms
yhcK

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    985,734 → 986,813

    The protein

    Catalyzed reaction/ biological activity

  • synthesis of c-di-GMP from two molecules of GTP [Pubmed|23893111]
  • [SW|Domains]

  • six transmembrane helices at the N-terminus (according to UniProt?)
  • contains a C-terminal [SW|GGDEF domain] (aa 223-357) [Pubmed|22821967]
  • Structure

  • [PDB|2WB4] (the C-terminal [SW|GGDEF domain], PleD from Caulobacter vibrioides, 44% identity)
  • [SW|Localization]

  • cell membrane at cell poles and septa, probably close to [protein|70ED3CE683F3A3F785480F40986CABE7729C17C7|YdaK] [pubmed|28536559]
  • present at a single site in the cell membrane [pubmed|32156823]
  • additional information

  • DgcK is present with about 6 molecules per cell [pubmed|32156823]
  • Expression and Regulation

    Operons

    genes
    [gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A656 (yhcK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/656 NBRP B. subtilis, Japan]
  • GP848 (''[gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]''::''ermC''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • BKE09120 (Δ[gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATATTATCACCCTTATA, downstream forward: _UP4_TGAATTCAATGTTCGAATTC
  • BKK09120 (Δ[gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATATTATCACCCTTATA, downstream forward: _UP4_TGAATTCAATGTTCGAATTC
  • References

  • 23893111,22821967,27116468,28536559,32156823