SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


pimeloyl-CoA synthase (6-carboxyhexanoate-CoA ligase)
29.48 kDa
protein length
259 aa Sequence Blast
gene length
777 bp Sequence Blast
biosynthesis of biotin
pimeloyl-CoA synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of biotin]
  • Gene

    3,094,679 → 3,095,455

    Phenotypes of a mutant

  • requires biotin for growth [Pubmed|28196402]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + CoA + heptanedioate --> AMP + diphosphate + heptanedioyl-CoA (according to UniProt)
  • Protein family

  • bioW family (single member, according to UniProt)
  • Structure

  • [PDB|5FLG] [pubmed|28414710]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|8763940,8892842], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|8763940,8892842]
  • view in new tab

    Biological materials


  • BKE30240 (Δ[gene|C40116089BAD3F9831F8C837DC4F2E045753ABDE|bioW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTTCTCGCCCTTTCA, downstream forward: _UP4_ATTTTAATAGAGTGGGAGGA
  • BKK30240 (Δ[gene|C40116089BAD3F9831F8C837DC4F2E045753ABDE|bioW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTTCTCGCCCTTTCA, downstream forward: _UP4_ATTTTAATAGAGTGGGAGGA
  • lacZ fusion

  • pBP627 (in [SW|pAC7]), available in [SW|Fabian Commichau]'s lab
  • References


  • 21437340
  • Original publications

  • 8763940,8892842,11717296,12368242,28196402,28414710