SubtiBank SubtiBank
yorV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yorV

unknown
locus
BSU_20240
pI
5.05
mw
8.33 kDa
protein length
gene length
219 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,171,139 → 2,171,357

    Biological materials

    Mutant

  • BKE20240 (Δ[gene|C3E2EB2462FB4EA98552DBCDFB0F1E00BBC97F9E|yorV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCGATCCACTCCTCTTA, downstream forward: _UP4_TCGTATTTAAAAGGAGAGTG
  • BKK20240 (Δ[gene|C3E2EB2462FB4EA98552DBCDFB0F1E00BBC97F9E|yorV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCGATCCACTCCTCTTA, downstream forward: _UP4_TCGTATTTAAAAGGAGAGTG