SubtiBank SubtiBank
ywcC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ywcC

transcription repressor ([SW|TetR family]), controls [gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] expression
locus
BSU_38220
pI
8.47
mw
25.96 kDa
protein length
223 aa Sequence Blast
gene length
672 bp Sequence Blast
function
control of [gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] expression
product
transcription repressor ([SW|TetR family])
essential
no
synonyms
ipa-33d

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • Gene

    Coordinates
    3,922,292 → 3,922,963

    The protein

    Protein family

  • [SW|TetR family]
  • [SW|Domains]

  • [SW|HTH tetR-type domain] (aa 11-71) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC]-[gene|FD30C4E458E63E8D6A932B351D4224F1AACD4B1B|gtcA]-[gene|36930CC6FDFCA23D43E264FEA375B78A1434E1BD|galK]-[gene|591428EA1C3D40322BB942429607AF61A90BAF41|galT]
    description
    [Pubmed|22383849,22893383]

    regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|10666464]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B230 (ywcC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1229 NBRP B. subtilis, Japan]
  • BKE38220 (Δ[gene|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTTCTCCTGGCGGT, downstream forward: _UP4_CAGTGAAGTATAGAGAAATA
  • BKK38220 (Δ[gene|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTTCTCCTGGCGGT, downstream forward: _UP4_CAGTGAAGTATAGAGAAATA
  • References

    Reviews

  • 24006471
  • Original publications

  • 18647168,22383849,22893383,19788541,27891125