SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


subunit of [SW|ABC transporter] for melibiose and raffinose (binding lipoprotein)
48.07 kDa
protein length
426 aa Sequence Blast
gene length
1281 bp Sequence Blast
uptake of melibiose and raffinose
[SW|ABC transporter] (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of melibiose]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,097,850 → 3,099,130

    The protein

    Catalyzed reaction/ biological activity

  • binding of melibiose and raffinose [pubmed|31138628]
  • Protein family

  • [SW|Bacterial solute-binding protein 1 family] (according to UniProt)
  • Structure

  • [PDB|4R6H]
  • [SW|Localization]

  • extracellular (signal peptide), associated to the cell membrane (via [protein|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|MelC]-[protein|05BFEA711D82395A55B505E5A38286BE2F570350|MelD]) [Pubmed|18957862,10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538,31138628], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]: repression, [pubmed|31138628], in [regulon|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR regulon]
  • regulation

  • induced by melibiose or raffinose ([protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]) [pubmed|31138628]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|22900538,31138628]
  • there is an additional RNA "upshift" signal in front of the [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE] gene suggestive of a [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] mRNA [Pubmed|22383849]. However, there is no promoter in front of [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE], suggesting that this mRNA may be the product of mRNA processing [pubmed|31138628]
  • view in new tab

    Biological materials


  • MGNA-A801 (msmE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30270 (Δ[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCCTCCTTATCAT, downstream forward: _UP4_TCCGAAACACAGGGAGCTGA
  • BKK30270 (Δ[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCCTCCTTATCAT, downstream forward: _UP4_TCCGAAACACAGGGAGCTGA
  • References

  • 10092453,22383849,22900538,18957862,31138628