SubtiBank SubtiBank
melE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

melE

subunit of [SW|ABC transporter] for melibiose and raffinose (binding lipoprotein)
locus
BSU30270
pI
5.85
mw
48.07 kDa
protein length
426 aa Sequence Blast
gene length
1281 bp Sequence Blast
function
uptake of melibiose and raffinose
product
[SW|ABC transporter] (binding protein)
essential
no
synonyms
msmE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.21|Utilization of melibiose]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,097,850 → 3,099,130

    The protein

    Catalyzed reaction/ biological activity

  • binding of melibiose and raffinose [pubmed|31138628]
  • Protein family

  • [SW|Bacterial solute-binding protein 1 family] (according to UniProt)
  • Structure

  • [PDB|4R6H]
  • [SW|Localization]

  • extracellular (signal peptide), associated to the cell membrane (via [protein|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|MelC]-[protein|05BFEA711D82395A55B505E5A38286BE2F570350|MelD]) [Pubmed|18957862,10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538,31138628], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]: repression, [pubmed|31138628], in [regulon|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR regulon]
  • regulation

  • induced by melibiose or raffinose ([protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]) [pubmed|31138628]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|22900538,31138628]
  • there is an additional RNA "upshift" signal in front of the [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE] gene suggestive of a [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] mRNA [Pubmed|22383849]. However, there is no promoter in front of [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE], suggesting that this mRNA may be the product of mRNA processing [pubmed|31138628]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A801 (msmE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/801 NBRP B. subtilis, Japan]
  • BKE30270 (Δ[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCCTCCTTATCAT, downstream forward: _UP4_TCCGAAACACAGGGAGCTGA
  • BKK30270 (Δ[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCCTCCTTATCAT, downstream forward: _UP4_TCCGAAACACAGGGAGCTGA
  • References

  • 10092453,22383849,22900538,18957862,31138628