SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


copper storage protein
11.70 kDa
protein length
108 aa Sequence Blast
gene length
327 bp Sequence Blast
prevention of copper toxicity
copper storage protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Copper]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    1,135,255 → 1,135,581

    The protein

    Catalyzed reaction/ biological activity

  • binding of Cu(I) ions (up to 80 ions per tetramer) to prevent copper toxicity [Pubmed|27991525]
  • Structure

  • [PDB|5FIG] [Pubmed|27991525]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12480901], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE], [protein|search|SigK], [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]) [Pubmed|12480901,15383836]
  • view in new tab

    Biological materials


  • MGNA-B288 (yhjQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10600 (Δ[gene|C3966AC2F7160228C3B155132B40F0AF71D6FECA|yhjQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTGATTCCCCCTGTA, downstream forward: _UP4_TAAAAAAGAGGGTTCAAAAA
  • BKK10600 (Δ[gene|C3966AC2F7160228C3B155132B40F0AF71D6FECA|yhjQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTGATTCCCCCTGTA, downstream forward: _UP4_TAAAAAAGAGGGTTCAAAAA
  • References


  • 29414794
  • Original publications

  • 27766092,27991525