SubtiBank SubtiBank
yhjQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhjQ

copper storage protein
locus
BSU_10600
pI
4.90
mw
11.70 kDa
protein length
108 aa Sequence Blast
gene length
327 bp Sequence Blast
function
prevention of copper toxicity
product
copper storage protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.1|Copper]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    1,135,255 → 1,135,581

    The protein

    Catalyzed reaction/ biological activity

  • binding of Cu(I) ions (up to 80 ions per tetramer) to prevent copper toxicity [Pubmed|27991525]
  • Structure

  • [PDB|5FIG] [Pubmed|27991525]
  • Expression and Regulation

    Operons

    genes
    [gene|90E4C0FFA7678C7034657237464C2B34EE261B79|yhjR]-[gene|C3966AC2F7160228C3B155132B40F0AF71D6FECA|yhjQ]
    description
    [Pubmed|22383849,12480901]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12480901], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE], [protein|search|SigK], [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]) [Pubmed|12480901,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B288 (yhjQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1287 NBRP B. subtilis, Japan]
  • BKE10600 (Δ[gene|C3966AC2F7160228C3B155132B40F0AF71D6FECA|yhjQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTGATTCCCCCTGTA, downstream forward: _UP4_TAAAAAAGAGGGTTCAAAAA
  • BKK10600 (Δ[gene|C3966AC2F7160228C3B155132B40F0AF71D6FECA|yhjQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTGATTCCCCCTGTA, downstream forward: _UP4_TAAAAAAGAGGGTTCAAAAA
  • References

    Reviews

  • 29414794
  • Original publications

  • 27766092,27991525