SubtiBank SubtiBank
ohrB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ohrB

general stress protein
locus
BSU13160
pI
4.00
mw
14.00 kDa
protein length
136 aa Sequence Blast
gene length
411 bp Sequence Blast
function
organic peroxide resistance
product
unknown
essential
no
synonyms
yzzE,ykzA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,382,020 → 1,382,430

    The protein

    Protein family

  • osmC/ohr family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|869E46AECF6249610F8541E403D834284B62171D|OhrA]
  • Modification

  • Cys55-Cys119 form catalytic disulfide bond [Pubmed|18084074]
  • Structure

  • [PDB|2BJO] [pubmed|18084074]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|C36DD4B670D803C5700428F62E6CA7ED127E4B41|ohrB]-[gene|9C8CF0AC3581D5FAA43A44D8B893D46E1A67C219|ykzN]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    genes
    [gene|C36DD4B670D803C5700428F62E6CA7ED127E4B41|ohrB]
    description
    [Pubmed|9696771]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • GP1728 [gene|C36DD4B670D803C5700428F62E6CA7ED127E4B41|ohrB]::spec trpC2 available at Jörg Stülkes lab
  • MGNA-A751 (ykzA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/751 NBRP B. subtilis, Japan]
  • BKE13160 (Δ[gene|C36DD4B670D803C5700428F62E6CA7ED127E4B41|ohrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCCCAACCTCCTTA, downstream forward: _UP4_TAATGACCGGCATCCTGAGG
  • BKK13160 (Δ[gene|C36DD4B670D803C5700428F62E6CA7ED127E4B41|ohrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCCCAACCTCCTTA, downstream forward: _UP4_TAATGACCGGCATCCTGAGG
  • References

  • 18084074,9696771,11418552,15805528