SubtiBank SubtiBank
gudB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gudB

glutamate dehydrogenase, trigger enzyme
locus
BSU_22960
pI
5.58
mw
47.05 kDa
protein length
427 aa Sequence Blast
gene length
1284 bp Sequence Blast
function
glutamate utilization, control of [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC] activity
product
glutamate dehydrogenase, trigger enzyme
essential
no
ec
1.4.1.2
synonyms
ypcA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.1|Utilization of glutamine/ glutamate]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.2|Trigger enzymes that control gene expression by protein-protein interaction with transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,402,067 → 2,403,350

    Phenotypes of a mutant

  • The gene is cryptic. If [gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB] is activated (gudB1 mutation), the bacteria are able to utilize glutamate as the only carbon source. [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=+18326565 PubMed]
  • A [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG] [gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB] mutant is sensitive to ß-lactam antibiotics such as cefuroxime and to fosfomycin due to the downregulation of the [SW|SigW regulon] [Pubmed|22178969]
  • transcription profile of a [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG] [gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB] mutant strain: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE34383&submit.x=22&submit.y=9 GEO] [Pubmed|22178969]
  • The protein

    Catalyzed reaction/ biological activity

  • H2O + L-glutamate + NAD+ --> 2-oxoglutarate + H+ + NADH + NH4+ (according to UniProt)
  • Protein family

  • Glu/Leu/Phe/Val dehydrogenases family (with [protein|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|Bcd] and [protein|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|RocG], according to UniProt)
  • Paralogous protein(s)

  • [protein|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|RocG]
  • Modification

  • phosphorylated on Arg-56, Arg-83, and Arg-421 and/or Arg-423 [Pubmed|22517742]
  • [SW|Cofactors]

  • NAD+/NADH + H+
  • Structure

  • [PDB|3K8Z] (enzymatically active GudB1) [Pubmed|20630473]
  • additional information

  • GudB is subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]
    description
    [Pubmed|22178973]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [PubMed|9829940], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutively expressed [Pubmed|22178973]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A397 (ypcA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/397 NBRP B. subtilis, Japan]
  • GP691 (''ΔgudB::cat''), GP1160 (''ΔgudB::aphA3'') both available in [SW|Jörg Stülke]'s lab
  • BKE22960 (Δ[gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAGTTAACCTCCTAG, downstream forward: _UP4_TAAGTTGATGATTTGCATAA
  • BKK22960 (Δ[gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAGTTAACCTCCTAG, downstream forward: _UP4_TAAGTTGATGATTTGCATAA
  • GP2834 (''gudB++''), available in [SW|Jörg Stülke]'s lab
  • Expression vectors

  • for purification of GudB from ''E. coli'' carrying an N-terminal Strep-tag: pGP863 (in [SW|pGP172]) available in [SW|Jörg Stülke]'s lab
  • for purification of GudB1 from ''E. coli'' carrying an N-terminal Strep-tag: pGP864 (in [SW|pGP172]) available in [SW|Jörg Stülke]'s lab
  • for ectopic expression of ''gudB'' with its native promoter: pGP900 (in [protein|search|pAC5]), available in [SW|Jörg Stülke]'s lab
  • wild type ''gudB'', expression in ''B. subtilis'', in [SW|pBQ200]: pGP1712, available in [SW|Jörg Stülke]'s lab
  • pBP179 (N-terminal Strep-tag ''gudB+'', purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Fabian Commichau]'s lab
  • lacZ fusion

  • pGP651 (in [SW|pAC5]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW| Fabian Commichau]'s lab
  • FLAG-tag construct

  • GP1194 (''gudB'', ''spc'', based on [SW|pGP1331]), GP1195 (''gudB1'', ''spc'', based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • antibody against [protein|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|RocG] recognizes GudB, available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • [SW|Fabian Commichau], Göttingen, Germany [http://www.uni-goettingen.de/de/413008.html homepage]
  • References

    Reviews

  • 19698086,8299344,7705101,19895831,22625175,28615289
  • Original publications

  • 18603778,9829940,17183217,18723616,18326565,20630473,17981983,21219666,22178973,22517742,23338837,22178969,23785476,24263382,24473333,25610436,25711804,28468957,28516784,30936490