SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


apurinic/apyrimidinic endonuclease , endonuclease III, removes abasic sites during base excision repair
24.85 kDa
protein length
219 aa Sequence Blast
gene length
660 bp Sequence Blast
DNA repair
endonuclease III

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|A/P endonucleases]
  • Gene

    2,344,755 → 2,345,414

    Phenotypes of a mutant

  • the mutant is sensititive to exposure to H2O2 [Pubmed|21954439]
  • The protein

    Catalyzed reaction/ biological activity

  • The C-O-P bond 3' to the apurinic or apyrimidinic site in DNA is broken by a beta-elimination reaction, leaving a 3'-terminal unsaturated sugar and a product with a terminal 5'-phosphate (according to UniProt)
  • Protein family

  • Nth/MutY family (with [protein|B62083CF18FC4C796D95B960CF62FA963FC26CDE|MutY], according to UniProt)
  • [SW|Domains]

  • HhH domain (aa 109-128) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Effectors of protein activity

  • activity is stimulated by untwisting of the DNA (by [protein|C9FEE07601AD28B2651EB881A1D9B34D5082237C|DnaD], [protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|Hbs], or [protein|3FFFA28E2C16508C6A94408B739864DB7F8DD1F7|YonN]) [Pubmed|21954439]
  • Structure

  • [PDB|1P59] (complex with DNA, Geobacillus stearothermophilus)
  • Expression and Regulation


    view in new tab



  • constitutively expressed [Pubmed|21954439]
  • view in new tab

    Biological materials


  • BKE22340 (Δ[gene|C352560155F5B2E951B5059794D7B319C1A3AF2C|nth]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAACACGATTGTCACCTTTT, downstream forward: _UP4_GATAAAAAAGGACTGGTGAA
  • BKK22340 (Δ[gene|C352560155F5B2E951B5059794D7B319C1A3AF2C|nth]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAACACGATTGTCACCTTTT, downstream forward: _UP4_GATAAAAAAGGACTGGTGAA
  • References


  • 22933559
  • Original publications

  • 12840008,21954439,24914186