SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


topological determinant of [SW|cell division], part of the Min system (with Z ring placement)
43.51 kDa
protein length
397 aa Sequence Blast
gene length
1194 bp Sequence Blast
[SW|cell division] site selection
topological determinant of [SW|cell division]

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW|The Min system]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,620,346 → 3,621,539

    Phenotypes of a mutant

  • inactivation of [gene|C3482F13AE7B7462D9A4C91C8B461B7987A2277D|minJ] reduces sporulation efficiency to 36% that of wild type cells; delayed entry into sporulation and aberrant forespores [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • The Min system prevents minicell formation adjacent to recently completed division sites by promoting the disassembly of the cytokinetic ring, thereby ensuring that cell division occurs only once per cell cycle [Pubmed|20352045]
  • required for oriC placement during spore development [Pubmed|27059541]
  • Protein family

  • MinJ family (single member, according to UniProt)
  • [SW|Domains]

  • 7 transmembrane helices (aa 15- 269) (according to UniProt)
  • [SW|PDZ domain] (aa 295 - 361) (according to UniProt)
  • [SW|Localization]

  • forms rings at the division septum [Pubmed|22108385]
  • cell membrane [Pubmed|23264578]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18567663], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|18567663], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, ([protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA] promoter) [Pubmed|18567663], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-B648 (minJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35220 (Δ[gene|C3482F13AE7B7462D9A4C91C8B461B7987A2277D|minJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATCTCTCACCGCCTCA, downstream forward: _UP4_TAAAAGGCAGCCCGGCACCG
  • BKK35220 (Δ[gene|C3482F13AE7B7462D9A4C91C8B461B7987A2277D|minJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATCTCTCACCGCCTCA, downstream forward: _UP4_TAAAAGGCAGCCCGGCACCG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Daniel Kearns], Indiana University, Bloomington, USA, [ homepage]
  • [SW|Marc Bramkamp], University of Cologne, Cologne, Germany [ homepage]
  • References


  • 19884039,24367361,28500523
  • Original Publications

  • 19019154,16030230,18976281,20352045,18567663,22108385,22457634,23264578,26735940,27059541,28674273,29403445