SubtiBank SubtiBank
minJ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

minJ

topological determinant of [SW|cell division], part of the Min system (with Z ring placement)
locus
BSU_35220
pI
9.06
mw
43.51 kDa
protein length
397 aa Sequence Blast
gene length
1194 bp Sequence Blast
function
[SW|cell division] site selection
product
topological determinant of [SW|cell division]
essential
no
synonyms
yvjD,swrAB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.1|The Min system]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,620,346 → 3,621,539

    Phenotypes of a mutant

  • inactivation of [gene|C3482F13AE7B7462D9A4C91C8B461B7987A2277D|minJ] reduces sporulation efficiency to 36% that of wild type cells; delayed entry into sporulation and aberrant forespores [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • The Min system prevents minicell formation adjacent to recently completed division sites by promoting the disassembly of the cytokinetic ring, thereby ensuring that cell division occurs only once per cell cycle [Pubmed|20352045]
  • required for oriC placement during spore development [Pubmed|27059541]
  • Protein family

  • MinJ family (single member, according to UniProt)
  • [SW|Domains]

  • 7 transmembrane helices (aa 15- 269) (according to UniProt)
  • [SW|PDZ domain] (aa 295 - 361) (according to UniProt)
  • [SW|Localization]

  • forms rings at the division septum [Pubmed|22108385]
  • cell membrane [Pubmed|23264578]
  • Expression and Regulation

    Operons

    genes
    [gene|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2]-[gene|C3482F13AE7B7462D9A4C91C8B461B7987A2277D|minJ]
    description
    [Pubmed|16030230]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18567663], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|18567663], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, ([protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA] promoter) [Pubmed|18567663], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • view in new tab

    genes
    [gene|C3482F13AE7B7462D9A4C91C8B461B7987A2277D|minJ]
    description
    [pubmed|18976281]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B648 (minJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1647 NBRP B. subtilis, Japan]
  • BKE35220 (Δ[gene|C3482F13AE7B7462D9A4C91C8B461B7987A2277D|minJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATCTCTCACCGCCTCA, downstream forward: _UP4_TAAAAGGCAGCCCGGCACCG
  • BKK35220 (Δ[gene|C3482F13AE7B7462D9A4C91C8B461B7987A2277D|minJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATCTCTCACCGCCTCA, downstream forward: _UP4_TAAAAGGCAGCCCGGCACCG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Daniel Kearns], Indiana University, Bloomington, USA, [http://www.bio.indiana.edu/facultyresearch/faculty/Kearns.html homepage]
  • [SW|Marc Bramkamp], University of Cologne, Cologne, Germany [http://www.kraemerlab.uni-koeln.de/celldivision.php homepage]
  • References

    Reviews

  • 19884039,24367361,28500523
  • Original Publications

  • 19019154,16030230,18976281,20352045,18567663,22108385,22457634,23264578,26735940,27059541,28674273,29403445