SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


purine nucleoside transporter
43.56 kDa
protein length
397 aa Sequence Blast
gene length
1194 bp Sequence Blast
purine uptake
purine nucleoside transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,005,752 → 4,006,945

    Phenotypes of a mutant

  • a ''[gene|19BA45BD691BBA4B23C4741C63DB729AA5D30FDA|nupN] [gene|C333F405F597FF260FFA0EC616B8CF6BF454815B|nupG]'' double mutant is unable to utilize externally provided guanosine [Pubmed|21926227]
  • The protein

    Protein family

  • SLC28A transporter family (according to Swiss-Prot)
  • Structure

  • [PDB|3TIJ] (from Vibrio cholerae, 25% identity) [pubmed|22407322]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|G-box|G-box]: termination, [Pubmed|12923093], in [regulon|G-box|G-box]
  • regulation

  • expression activated by glucose (4.3 fold) [Pubmed|12850135]
  • the [SW|G-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B725 (yxjA::erm), available at the [ NBRP B. subtilis, Japan]
  • CS219 (''[gene|C333F405F597FF260FFA0EC616B8CF6BF454815B|nupG]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE39020 (Δ[gene|C333F405F597FF260FFA0EC616B8CF6BF454815B|nupG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAGCAACTCCTATGA, downstream forward: _UP4_TAGAAACATTGAGCCATATC
  • BKK39020 (Δ[gene|C333F405F597FF260FFA0EC616B8CF6BF454815B|nupG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAGCAACTCCTATGA, downstream forward: _UP4_TAGAAACATTGAGCCATATC
  • References

  • 12850135,18763711,12923093,21926227,27197833,22407322,29794222