SubtiBank SubtiBank
nupG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

nupG

purine nucleoside transporter
locus
BSU_39020
pI
7.76
mw
43.56 kDa
protein length
397 aa Sequence Blast
gene length
1194 bp Sequence Blast
function
purine uptake
product
purine nucleoside transporter
essential
no
synonyms
yxjA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.6|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,005,752 → 4,006,945

    Phenotypes of a mutant

  • a ''[gene|19BA45BD691BBA4B23C4741C63DB729AA5D30FDA|nupN] [gene|C333F405F597FF260FFA0EC616B8CF6BF454815B|nupG]'' double mutant is unable to utilize externally provided guanosine [Pubmed|21926227]
  • The protein

    Protein family

  • concentrative nucleoside transporter (CNT) (TC 2.A.41) family (with [protein|4F718681A7AD0C86B2551248570F493AC0B2E7E9|NupC] and [protein|7D4CF2FF4108D3AE170C1EE3C7D494EAD46699C6|YutK], according to UniProt)
  • Structure

  • [PDB|3TIJ] (from Vibrio cholerae, 25% identity) [pubmed|22407322]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|C333F405F597FF260FFA0EC616B8CF6BF454815B|nupG]

    regulatory mechanism

  • [regulon|G-box|G-box]: termination, [Pubmed|12923093], in [regulon|G-box|G-box]
  • regulation

  • expression activated by glucose (4.3 fold) [Pubmed|12850135]
  • the [SW|G-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B725 (yxjA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1724 NBRP B. subtilis, Japan]
  • CS219 (''[gene|C333F405F597FF260FFA0EC616B8CF6BF454815B|nupG]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE39020 (Δ[gene|C333F405F597FF260FFA0EC616B8CF6BF454815B|nupG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAGCAACTCCTATGA, downstream forward: _UP4_TAGAAACATTGAGCCATATC
  • BKK39020 (Δ[gene|C333F405F597FF260FFA0EC616B8CF6BF454815B|nupG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAGCAACTCCTATGA, downstream forward: _UP4_TAGAAACATTGAGCCATATC
  • References

  • 12850135,18763711,12923093,21926227,27197833,22407322,29794222