SubtiBank SubtiBank
yetH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yetH

similar to antibiotic binding protein
locus
BSU_07160
pI
4.52
mw
13.49 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    785,543 → 785,905

    The protein

    [SW|Domains]

  • [SW|VOC domain] (aa 4-120) (according to UniProt)
  • Structure

  • [PDB|5UMQ] (from Streptomyces sp., 40% identity) [pubmed|29937405]
  • Expression and Regulation

    Operons

    genes
    [gene|C32EB71BE4F37F37154860E35A8D95DC71138A4F|yetH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B459 (yetH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1458 NBRP B. subtilis, Japan]
  • BKE07160 (Δ[gene|C32EB71BE4F37F37154860E35A8D95DC71138A4F|yetH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGGAAACCTCCAAGTT, downstream forward: _UP4_TAAACTGTTGCGCACGGCGG
  • BKK07160 (Δ[gene|C32EB71BE4F37F37154860E35A8D95DC71138A4F|yetH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGGAAACCTCCAAGTT, downstream forward: _UP4_TAAACTGTTGCGCACGGCGG
  • References

    Research papers

  • 29937405