SubtiBank SubtiBank
yozC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yozC

unknown
locus
BSU_19300
pI
8.09
mw
7.93 kDa
protein length
gene length
204 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,100,147 → 2,100,350

    Biological materials

    Mutant

  • BKE19300 (Δ[gene|C31B62E54FB45C3210693AAE601F88907E87B9B5|yozC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGAAATCTCCTTTTC, downstream forward: _UP4_TAATGCTTCCTTGAAGCATC
  • BKK19300 (Δ[gene|C31B62E54FB45C3210693AAE601F88907E87B9B5|yozC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGAAATCTCCTTTTC, downstream forward: _UP4_TAATGCTTCCTTGAAGCATC