SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


2-keto-myo-inositol dehydratase, dehydration of 2-keto-myo-inositol (2nd reaction)
33.44 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
myo-inositol catabolism
2-keto-myo-inositol dehydratase, dehydration of 2-keto-myo-inositol (2nd reaction)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of inositol]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    4,078,173 → 4,079,066

    The protein

    Catalyzed reaction/ biological activity

  • 2,4,6/3,5-pentahydroxycyclohexanone = 3,5/4-trihydroxycyclohexa-1,2-dione + H2O (according to Swiss-Prot)
  • Protein family

  • iolE/mocC family (according to Swiss-Prot)
  • Structure

  • [PDB|3CNY] (from ''Lactobacillus plantarum wcfs1 mutant'', 63% identity, 78% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9887260,9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
  • view in new tab

    Biological materials


  • MGNA-B774 (iolE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39720 (Δ[gene|C31AF6C8050D453D9011B0793403791F1851BA69|iolE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGCCCATCTATGGTGCCT, downstream forward: _UP4_CTGGCTTAATGGGGAATGAA
  • BKK39720 (Δ[gene|C31AF6C8050D453D9011B0793403791F1851BA69|iolE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGCCCATCTATGGTGCCT, downstream forward: _UP4_CTGGCTTAATGGGGAATGAA
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 9226270,14993306,9887260,18310071,14993306