SubtiBank SubtiBank
pucF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pucF

allantoate amidohydrolase
locus
BSU32530
pI
5.36
mw
45.36 kDa
protein length
412 aa Sequence Blast
gene length
1239 bp Sequence Blast
function
purine utilization
product
allantoate amidohydrolase
essential
no
synonyms
yurH

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    Coordinates
    3,342,433 → 3,343,671

    The protein

    Protein family

  • [SW|peptidase M20 family] (according to UniProt)
  • Structure

  • [PDB|2IMO] (from ''Escherichia coli k12'', 47% identity, 63% similarity) [Pubmed|17362992]
  • Expression and Regulation

    Operons

    genes
    [gene|C314CE9D194E8894430368C5F69C0778D45A651C|pucF]-[gene|4BC4B3E0AB4779D1DD5EDF591361FC1094AF661F|pucG]
    description
    [Pubmed|12029039]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • induced in the presence of purine nucleotides (inducer: allantoin) ([protein|search|PucR]) [Pubmed|12029039]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A943 (yurH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/943 NBRP B. subtilis, Japan]
  • BKE32530 (Δ[gene|C314CE9D194E8894430368C5F69C0778D45A651C|pucF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACTCCCCCCTCTGGC, downstream forward: _UP4_GCTTACTGATAAAGGAGGAA
  • BKK32530 (Δ[gene|C314CE9D194E8894430368C5F69C0778D45A651C|pucF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACTCCCCCCTCTGGC, downstream forward: _UP4_GCTTACTGATAAAGGAGGAA
  • References

  • 11344136,12029039