SubtiBank SubtiBank
yflK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yflK

similar to hydroxylaminopurine resistance protein
locus
BSU_07650
pI
7.76
mw
24.69 kDa
protein length
221 aa Sequence Blast
gene length
666 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.7|Detoxification reactions]
  • Gene

    Coordinates
    838,077 → 838,742

    The protein

    [SW|Domains]

  • MOSC domain (aa 33-167) (according to UniProt)
  • Structure

  • [PDB|5YHH] (from Geobacillus stearothermophilus, 50% identity) [pubmed|29459651]
  • Expression and Regulation

    Operons

    genes
    [gene|B51ADFB53CA54309D866BB089502639E9571238B|nos]-[gene|C2E28821689A07B9AA1B0BD5C84D856C04D83E95|yflK]
    description
    [Pubmed|22383849]

    additional information

  • Note that the [gene|D7C46835B9984E2C5E375816F2BB16566202CF27|yflL] is located between [gene|B51ADFB53CA54309D866BB089502639E9571238B|nos] and [gene|C2E28821689A07B9AA1B0BD5C84D856C04D83E95|yflK], but on the opposite strand
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C335 (yflK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2333 NBRP B. subtilis, Japan]
  • BKE07650 (Δ[gene|C2E28821689A07B9AA1B0BD5C84D856C04D83E95|yflK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAACACATCCCCTTT, downstream forward: _UP4_TAGAAAAAAGCCGCGCATAT
  • BKK07650 (Δ[gene|C2E28821689A07B9AA1B0BD5C84D856C04D83E95|yflK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAACACATCCCCTTT, downstream forward: _UP4_TAGAAAAAAGCCGCGCATAT
  • References

  • 11886751,29459651