SubtiBank SubtiBank
yqaR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqaR

unknown
locus
BSU_26210
pI
5.29
mw
17.97 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,690,381 → 2,690,845

    Expression and Regulation

    Operons

    genes
    [gene|C2D59AF2B2D1B9E9FCB4826908A1311FEFC6D193|yqaR]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE26210 (Δ[gene|C2D59AF2B2D1B9E9FCB4826908A1311FEFC6D193|yqaR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTCATCCCCTCCTTTT, downstream forward: _UP4_TAAGCTTCTTTTGAGGAGCT
  • BKK26210 (Δ[gene|C2D59AF2B2D1B9E9FCB4826908A1311FEFC6D193|yqaR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTCATCCCCTCCTTTT, downstream forward: _UP4_TAAGCTTCTTTTGAGGAGCT
  • References

  • 26577401