SubtiBank SubtiBank
yqeD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqeD

unknown
locus
BSU_25720
pI
10.58
mw
22.79 kDa
protein length
208 aa Sequence Blast
gene length
627 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,649,842 → 2,650,468

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C277A10CD90F143CB93844B35DC3F10781769135|yqeD]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE25720 (Δ[gene|C277A10CD90F143CB93844B35DC3F10781769135|yqeD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTATGGTCACTCCCA, downstream forward: _UP4_AAATAAGGAGGCTTGTTGGC
  • BKK25720 (Δ[gene|C277A10CD90F143CB93844B35DC3F10781769135|yqeD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTATGGTCACTCCCA, downstream forward: _UP4_AAATAAGGAGGCTTGTTGGC