SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


small membrane protein
16.29 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,431,027 → 1,431,458

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A788 (eag::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13650 (Δ[gene|C2506D988C00CBA01C3073B3D67AD79FC81A26CA|eag]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTTCCCTCTTTCATA, downstream forward: _UP4_TAAAAAACCCTCCTGACATG
  • BKK13650 (Δ[gene|C2506D988C00CBA01C3073B3D67AD79FC81A26CA|eag]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTTCCCTCTTTCATA, downstream forward: _UP4_TAAAAAACCCTCCTGACATG
  • References

  • 2838724