SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


two-component response regulator ([SW|OmpR family]), regulation of [gene|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA]-[gene|search|bceB ]in response to external (bacitracin, plectasin, mersacidin and actagardine) and internal ([protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC], [protein|DDB0022F50999AC52809D651C9CC5A5FDC71302C|SkfA]) antimicrobial peptides
26.72 kDa
protein length
231 aa Sequence Blast
gene length
696 bp Sequence Blast
resistance against toxic peptides
two-component response regulator ([SW|OmpR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    3,113,187 → 3,113,882

    The protein

    Protein family

  • [SW|OmpR family]
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 3-116) (according to UniProt)
  • Modification

  • phosphorylated by [protein|08F24CA21DC54031F6158AC0C772F3B520E5A849|BceS] on an Asp residue
  • Structure

  • [PDB|1KGS] (DrrD from ''Thermotoga maritima '', 32% identity) [Pubmed|11839301]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A133 (ytsA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30400 (Δ[gene|C239C155F5452C86BF6C78190BABBBB07A63DF87|bceR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCGACTCACCGCACTTT, downstream forward: _UP4_ATCGCGAAGGAAGAGGACAA
  • BKK30400 (Δ[gene|C239C155F5452C86BF6C78190BABBBB07A63DF87|bceR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCGACTCACCGCACTTT, downstream forward: _UP4_ATCGCGAAGGAAGAGGACAA
  • References


  • 27344142,28152228,29404338
  • Original publications

  • 10094672,18394148,12890034,14651641,21283517,20606066,17905982,25118291,22964256,21078927,26199330,26364265,11839301,27997719