SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


imidazole glycerol phosphate synthase (synthase subunit)
27.14 kDa
protein length
252 aa Sequence Blast
gene length
759 bp Sequence Blast
biosynthesis of histidine
imidazole glycerol phosphate synthase (synthase subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of histidine]
  • Gene

    3,583,562 → 3,584,320

    The protein

    Catalyzed reaction/ biological activity

  • 5-[(5-phospho-1-deoxyribulos-1-ylamino)methylideneamino]-1-(5-phosphoribosyl)imidazole-4-carboxamide L-glutamine = imidazole-glycerol phosphate 5-aminoimidazol-4-carboxamide ribonucleotide L-glutamate H2O (according to Swiss-Prot)
  • Protein family

  • hisA/hisF family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|148F0C7983250F50676D234DB713E532AA55DDBF|HisA]
  • Structure

  • [PDB|1KA9] (the [protein|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|HisF]-[protein|DEB3122A3EA36545759FAA6F86F71F971CA5F011|HisH] complex from ''Thermus thermophilus'', 59% identity) [Pubmed|12417026]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • expression depends on functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • BKE34870 (Δ[gene|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCATGGGATAATCCGTTTTG, downstream forward: _UP4_AAAGAGTACGGGGTGAATGT
  • BKK34870 (Δ[gene|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCATGGGATAATCCGTTTTG, downstream forward: _UP4_AAAGAGTACGGGGTGAATGT
  • References


  • 12859215
  • Original publications

  • 12107147,15378759,12417026,27766092