SubtiBank SubtiBank
ydiD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydiD

similar to to ribosomal-protein-alanine N-acetyltransferase
locus
BSU_05930
pI
5.67
mw
17.23 kDa
protein length
151 aa Sequence Blast
gene length
456 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
2.3.1.128
synonyms
rimI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.13|Translation/ other/ based on similarity]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.6|Protein acetylase/ deacetylase/ based on similarity]
  • Gene

    Coordinates
    642,810 → 643,265

    The protein

    Catalyzed reaction/ biological activity

  • Acetyl-CoA ribosomal-protein L-alanine = CoA ribosomal-protein N-acetyl-L-alanine (according to Swiss-Prot)
  • Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • Structure

  • [PDB|2CNM]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|DE32F1DA1EA1164411E0605262381BD38A49656C|thiL]-[gene|E15BB518649B2B9CD44CEBBB4FA481E55BCE823C|tsaE]-[gene|6CB350C335603D5F4434679F9D740BFECA738599|tsaB]-[gene|C2283BDD806221A285A27F24F52F92F4D47F0C55|ydiD]-[gene|30393F16CFE89E7BAD233A0BD27B77D679F7E409|tsaD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C198 (ydiD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2196 NBRP B. subtilis, Japan]
  • BKE05930 (Δ[gene|C2283BDD806221A285A27F24F52F92F4D47F0C55|ydiD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTGTTTTCATCCTAT, downstream forward: _UP4_GCGTTAATTATGTGGGTGAC
  • BKK05930 (Δ[gene|C2283BDD806221A285A27F24F52F92F4D47F0C55|ydiD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTGTTTTCATCCTAT, downstream forward: _UP4_GCGTTAATTATGTGGGTGAC
  • References

  • 22383849