SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to to ribosomal-protein-alanine N-acetyltransferase
17.23 kDa
protein length
151 aa Sequence Blast
gene length
456 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation/ other/ based on similarity]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein acetylase/ deacetylase/ based on similarity]
  • Gene

    642,810 → 643,265

    The protein

    Catalyzed reaction/ biological activity

  • acetyl-CoA + N-terminal L-alanyl-[ribosomal protein bS18] --> CoA + H+ + N-terminal Nα-acetyl-L-alanyl-[ribosomal protein bS18] (according to UniProt)
  • Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 5-150) (according to UniProt)
  • Structure

  • [PDB|2CNM]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C198 (ydiD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05930 (Δ[gene|C2283BDD806221A285A27F24F52F92F4D47F0C55|ydiD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTGTTTTCATCCTAT, downstream forward: _UP4_GCGTTAATTATGTGGGTGAC
  • BKK05930 (Δ[gene|C2283BDD806221A285A27F24F52F92F4D47F0C55|ydiD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTGTTTTCATCCTAT, downstream forward: _UP4_GCGTTAATTATGTGGGTGAC
  • References

  • 22383849