SubtiBank SubtiBank
pyrK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pyrK

dihydroorotic acid dehydrogenase (electron transfer subunit)
locus
BSU_15530
pI
5.58
mw
27.95 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
function
pyrimidine biosynthesis
product
dihydroorotic acid dehydrogenase (electron transfer subunit)
essential
no
synonyms
pyrDII,ylxD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    Coordinates
    1,626,948 → 1,627,718

    The protein

    Protein family

  • PyrK family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|FAD-binding FR-type domain] (aa 1-101) (according to UniProt)
  • [SW|Cofactors]

  • [2Fe-2S] cluster [pubmed|29292548,11188687]
  • FAD [pubmed|11188687]
  • Structure

  • [PDB|1EP1] (from Lactococcus lactis, 46% identity) [pubmed|11188687]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
    description
    [Pubmed|8206849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials

    Mutant

  • BKE15530 (Δ[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACATACTGTCAAATACGCTT, downstream forward: _UP4_AAAGCTCAGGAGGTGGCGCT
  • BKK15530 (Δ[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACATACTGTCAAATACGCTT, downstream forward: _UP4_AAAGCTCAGGAGGTGGCGCT
  • References

  • 8206849,8759868,1709162,10545205,15378759,11188687