SubtiBank SubtiBank
pyrK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pyrK

dihydroorotic acid dehydrogenase (electron transfer subunit)
locus
BSU15530
pI
5.58
mw
27.95 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
function
pyrimidine biosynthesis
product
dihydroorotic acid dehydrogenase (electron transfer subunit)
essential
no
synonyms
pyrDII,ylxD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    Coordinates
    1,626,948 → 1,627,718

    The protein

    Protein family

  • FAD-binding FR-type domain (according to Swiss-Prot)
  • [SW|Cofactors]

  • [2Fe-2S] cluster [pubmed|29292548,11188687]
  • FAD [pubmed|11188687]
  • Structure

  • [PDB|1EP1] (from Lactococcus lactis, 46% identity) [pubmed|11188687]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
    description
    [Pubmed|8206849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials

    Mutant

  • BKE15530 (Δ[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACATACTGTCAAATACGCTT, downstream forward: _UP4_AAAGCTCAGGAGGTGGCGCT
  • BKK15530 (Δ[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACATACTGTCAAATACGCTT, downstream forward: _UP4_AAAGCTCAGGAGGTGGCGCT
  • References

  • 8206849,8759868,1709162,10545205,15378759,11188687