SubtiBank SubtiBank
araN [2019-04-15 19:56:05]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

araN [2019-04-15 19:56:05]

[SW|ABC transporter] for the uptake of α-1,5-arabinooligosaccharides, at least up to four L-arabinosyl units (sugar-binding protein)
48.48 kDa
protein length
433 aa Sequence Blast
gene length
1302 bp Sequence Blast
uptake of α-1,5-arabinooligosaccharides
α-1,5-arabinooligosaccharide [SW|ABC transporter ](sugar-binding protein))

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of arabinan/ arabinose/ arabitol]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,941,674 → 2,942,975

    The protein

    Protein family

  • [SW|Bacterial solute-binding protein 1 family] (according to UniProt)
  • Structure

  • [PDB|5YSB] (from Listeria innocua, 28% identity) [pubmed|29678880]
  • [SW|Localization]

  • cell membrane (via [protein|8AF43CA410F3381209196E1B9A4FE66D78020793|AraP]-[protein|AE532A8931D516CC676E765D1D1293E73C335D23|AraQ]) [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9084180], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12949161], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|A567466894AE9DE7CDE7816615433A37532297B5|AraR]: repression, [Pubmed|10417639], in [regulon|A567466894AE9DE7CDE7816615433A37532297B5|AraR regulon]
  • regulation

  • induced by arabinose ([protein|search|AraR]) [Pubmed|10417639]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • MGNA-B004 (araN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE28750 (Δ[gene|C1F5D0EA21DCA5F8EC43720CDF67E859CA7B866E|araN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGCGTTACCCCTTCCA, downstream forward: _UP4_TAGAATCCCATTCAAAAAGT
  • BKK28750 (Δ[gene|C1F5D0EA21DCA5F8EC43720CDF67E859CA7B866E|araN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGCGTTACCCCTTCCA, downstream forward: _UP4_TAGAATCCCATTCAAAAAGT
  • References

  • 10092453,10417639,9084180,20693325,29678880