SubtiBank SubtiBank
blyA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

blyA

N-acetylmuramoyl-L-alanine amidase
locus
BSU_21410
pI
9.94
mw
39.47 kDa
protein length
367 aa Sequence Blast
gene length
1104 bp Sequence Blast
function
SPß-mediated lysis
product
N-acetylmuramoyl-L-alanine amidase
essential
no
ec
3.5.1.28
synonyms
yomC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,263,489 → 2,264,592

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell-wall glycopeptides (according to UniProt)
  • Protein family

  • [SW|N-acetylmuramoyl-L-alanine amidase 2 family] (according to UniProt)
  • [SW|Domains]

  • contains an amidase_2 domain (like [protein|C9C395A5F6A2C06EAC97F228C5C66D1628C937CF|CwlA], [protein|D5612882F1887BE342EF7072E71502382AB7289F|CwlH], [protein|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|XlyA], [protein|A8AF827637B7208DFA101C9A2911BF9AB1AED08F|XlyB])
  • 2 [SW|SH3B domain]s 1 (aa 202-271, aa 298-367) (according to UniProt)
  • [SW|N-acetylmuramoyl-L-alanine amidase domain] (aa 24-158) (according to UniProt)
  • [SW|Localization]

  • secreted (according to UniProt)
  • Biological materials

    Mutant

  • BKE21410 (Δ[gene|C1EB8D05386C1B35B8002239F5247CC6AB25F786|blyA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACATCTCCTTAAT, downstream forward: _UP4_TAATTATATTCAATTTTCTC
  • BKK21410 (Δ[gene|C1EB8D05386C1B35B8002239F5247CC6AB25F786|blyA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACATCTCCTTAAT, downstream forward: _UP4_TAATTATATTCAATTTTCTC
  • References

  • 9579063