SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


petrobactin (3.4-catecholate siderophore) [SW|ABC transporter] (binding protein), major component of the secretome
34.64 kDa
protein length
317 aa Sequence Blast
gene length
954 bp Sequence Blast
[SW|acquisition of iron]
petrobactin [SW|ABC transporter] (binding protein)
yclQ, fpiA

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    435,036 → 435,989

    The protein

    Catalyzed reaction/ biological activity

  • uptake of the siderophore petrobactin [Pubmed|19955416]
  • Protein family

  • [SW|Bacterial solute-binding protein 8 family] (according to UniProt)
  • [SW|Domains]

  • [SW|Fe/B12 periplasmic-binding domain] (aa 56-317) (according to UniProt)
  • Structure

  • [PDB|3GFV]
  • [SW|Localization]

  • associated to the membrane (via [protein|552D4C42DCEA4625000160D2625711C61AB11661|FpbN]-[protein|EC63B5CDFDB4DF3A967ECEC40F2C44849311148B|FpbO]) [Pubmed|10092453,18763711]
  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,12354229]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • MGNA-C067 (yclQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03830 (Δ[gene|C1D6D188E5BD039F32427B2A58BBFC0CC173A476|fpbQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCCTCACCTCTTCTA, downstream forward: _UP4_TAAAACCAAAAAGAGCCTCC
  • BKK03830 (Δ[gene|C1D6D188E5BD039F32427B2A58BBFC0CC173A476|fpbQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCCTCACCTCTTCTA, downstream forward: _UP4_TAAAACCAAAAAGAGCCTCC
  • References

  • 10092453,19955416,12354229,18957862,18763711,26883633,29133393
  • synonyms