SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


34.63 kDa
protein length
309 aa Sequence Blast
gene length
930 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,691,642 → 2,692,571

    Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • BKE26230 (Δ[gene|C1C11ED790D5552A275419DEE04250840CED6723|yqaP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAACAACCTCCACTAC, downstream forward: _UP4_TAACCTGCACATCCAAGCCG
  • BKK26230 (Δ[gene|C1C11ED790D5552A275419DEE04250840CED6723|yqaP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAACAACCTCCACTAC, downstream forward: _UP4_TAACCTGCACATCCAAGCCG
  • References

  • 20817675, 11918677