SubtiBank SubtiBank
gapB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gapB

glyceraldehyde-3-phosphate dehydrogenase, NADP-dependent, gluconeogenic enzyme, forms a transhydrogenation cycle with GapA for balancing of NADPH
locus
BSU29020
pI
6.45
mw
37.32 kDa
protein length
340 aa Sequence Blast
gene length
1023 bp Sequence Blast
function
anabolic enzyme in gluconeogenesis
product
glyceraldehyde-3-phosphate dehydrogenase 2
essential
no
ec
1.2.1.59
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]
  • Gene

    Coordinates
    2,967,032 → 2,968,054

    Phenotypes of a mutant

  • inactivation of ''[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]'' reduces sporulation efficiency to 0.3% that of wild type cells; delayed entry into sporulation and fewer sporulating cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • D-glyceraldehyde 3-phosphate + phosphate + NAD(P)+ = 3-phospho-D-glyceroyl phosphate + NAD(P)H (according to Swiss-Prot)
  • This reaction is part of the gluconeogenesis
  • Protein family

  • glyceraldehyde-3-phosphate dehydrogenase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|EB6512177418B1601C6641FB2DEE99C2CD10E671|GapA]
  • Kinetic information

  • Michaelis-Menten [Pubmed|10799476]
  • [SW|Domains]

  • Nucleotid bindinge domain (12-13)
  • 2x Glyceraldehyde 3-phosphate binding domain (151-153) & (210-211)
  • [SW|Cofactors]

  • NADP+ (preferentially) and NAD+ [Pubmed|10799476]
  • Structure

  • [PDB|3PRL] (from ''B. halodurans'')
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • additional information

  • degraded after a shift from malate to glucose with an estimated half-life time of approx. 3 hours by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [pubmed|28760849]
  • Expression and Regulation

    Operons

    genes
    [gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]-[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]
    description
    [Pubmed|15720552]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15720552], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN]: repression, [Pubmed|15720552], in [regulon|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN regulon]
  • regulation

  • ''[protein|search|gapB]'': repressed in the presence of glucose ([protein|search|CcpN]) [Pubmed|15720552]
  • additional information

  • '[protein|search|speD]': the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the monocistronic 'speD' mRNA increases from 1.4 to 36 min) [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A121 (gapB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/121 NBRP B. subtilis, Japan]
  • GP701 (''gapB''::''spec''), available in [SW|Stülke] lab
  • 1A1004 ( ''gapB''::''erm''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1004&Search=1A1004 BGSC]
  • BKE29020 (Δ[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGGACACCCCTTATC, downstream forward: _UP4_TAAAATAAGGTCATGGACAC
  • BKK29020 (Δ[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGGACACCCCTTATC, downstream forward: _UP4_TAAAATAAGGTCATGGACAC
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 16479537,10799476,10844697,15720552,18586936,17114254,22190493,23033921,22740702,26735940,28760849