SubtiBank SubtiBank
gapB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gapB

glyceraldehyde-3-phosphate dehydrogenase, NADP-dependent, gluconeogenic enzyme, forms a transhydrogenation cycle with GapA for balancing of NADPH
locus
BSU_29020
pI
6.45
mw
37.32 kDa
protein length
340 aa Sequence Blast
gene length
1023 bp Sequence Blast
function
anabolic enzyme in gluconeogenesis
product
glyceraldehyde-3-phosphate dehydrogenase 2
essential
no
ec
1.2.1.59
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]
  • Gene

    Coordinates
    2,967,032 → 2,968,054

    Phenotypes of a mutant

  • inactivation of ''[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]'' reduces sporulation efficiency to 0.3% that of wild type cells; delayed entry into sporulation and fewer sporulating cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • D-glyceraldehyde 3-phosphate + NADP+ + phosphate --> 3-phospho-D-glyceroyl phosphate + H+ + NADPH(according to UniProt)
  • D-glyceraldehyde 3-phosphate + NAD+ + phosphate --> 3-phospho-D-glyceroyl phosphate + H+ + NADH (according to UniProt)
  • This reaction is part of the gluconeogenesis
  • Protein family

  • glyceraldehyde-3-phosphate dehydrogenase family (with [protein|EB6512177418B1601C6641FB2DEE99C2CD10E671|GapA], according to UniProt)
  • Paralogous protein(s)

  • [protein|EB6512177418B1601C6641FB2DEE99C2CD10E671|GapA]
  • Kinetic information

  • Michaelis-Menten [Pubmed|10799476]
  • [SW|Domains]

  • Nucleotid bindinge domain (12-13)
  • 2x Glyceraldehyde 3-phosphate binding domain (151-153) & (210-211)
  • [SW|Cofactors]

  • NADP+ (preferentially) and NAD+ [Pubmed|10799476]
  • Structure

  • [PDB|3PRL] (from ''B. halodurans'')
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • additional information

  • degraded after a shift from malate to glucose with an estimated half-life time of approx. 3 hours by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [pubmed|28760849]
  • Expression and Regulation

    Operons

    genes
    [gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]-[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]
    description
    [Pubmed|15720552]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15720552], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN]: repression, [Pubmed|15720552], in [regulon|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN regulon]
  • regulation

  • ''[protein|search|gapB]'': repressed in the presence of glucose ([protein|search|CcpN]) [Pubmed|15720552]
  • additional information

  • '[protein|search|speD]': the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the monocistronic 'speD' mRNA increases from 1.4 to 36 min) [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A121 (gapB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/121 NBRP B. subtilis, Japan]
  • GP701 (''gapB''::''spec''), available in [SW|Stülke] lab
  • 1A1004 ( ''gapB''::''erm''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1004&Search=1A1004 BGSC]
  • BKE29020 (Δ[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGGACACCCCTTATC, downstream forward: _UP4_TAAAATAAGGTCATGGACAC
  • BKK29020 (Δ[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGGACACCCCTTATC, downstream forward: _UP4_TAAAATAAGGTCATGGACAC
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 16479537,10799476,10844697,15720552,18586936,17114254,22190493,23033921,22740702,26735940,28760849