SubtiBank SubtiBank
motI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

motI

c-di-GMP receptor protein, inhibits flagellar rotation at high c-di-GMP concentrations
locus
BSU_22910
pI
7.88
mw
24.98 kDa
protein length
217 aa Sequence Blast
gene length
654 bp Sequence Blast
function
control of [protein|search|MotA ]activity
product
c-di-GMP receptor protein
essential
no
synonyms
dgrA,ypfA,jofA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.2|Targets of c-di-GMP]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.5|Additional chemotaxis signal transduction and regulatory proteins]
  • Gene

    Coordinates
    2,397,019 → 2,397,672

    The protein

    [SW|Domains]

  • contains a C-terminal PilZ domain [Pubmed|22821967]
  • PilZ domain (aa 98-203) (according to UniProt)
  • [SW|Cofactors]

  • c-di-GMP [Pubmed|22821967]
  • Effectors of protein activity

  • binding of c-di-GMP stimulates the inhibitory interaction with [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|MotA] [Pubmed|22821967]
  • Structure

  • [PDB|5VX6] (complex with c-di-GMP) [pubmed|29196522]
  • [SW|Localization]

  • forms [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|MotA]-dependent spots at the membrane [pubmed|29196522]
  • Expression and Regulation

    Operons

    genes
    [gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]-[gene|3459BA0CDAABC288ADF97B111F78C7EAC184840D|ypfB]-[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]-[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]-[gene|3459BA0CDAABC288ADF97B111F78C7EAC184840D|ypfB]-[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A419 (ypfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/419 NBRP B. subtilis, Japan]
  • BKE22910 (Δ[gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGACTTCACTCTTTCGC, downstream forward: _UP4_TAAACATCGGCAAACACTTC
  • BKK22910 (Δ[gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGACTTCACTCTTTCGC, downstream forward: _UP4_TAAACATCGGCAAACACTTC
  • References

    Reviews

  • 25251856,31136265
  • Original Publications

  • 23893111,22821967,29196522