SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component sensor kinase, regulation of the [gene|1A415DC85354373EA4866733C3AE43F510BD3C56|glsA]-[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT] operon
44.00 kDa
protein length
410 aa Sequence Blast
gene length
1233 bp Sequence Blast
regulation of the [gene|1A415DC85354373EA4866733C3AE43F510BD3C56|glsA]-[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT] operon
two-component sensor kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of glutamine/ glutamate]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    265,476 → 266,708

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|GlnL]
  • [SW|Domains]

  • four transmembrane segments, C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE02440 (Δ[gene|C18B886D06879C64B64606371E85A7D4D22DCFAC|glnK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGGCCAGTATATATC, downstream forward: _UP4_ATTCAGAAAGGGTGAACCAA
  • BKK02440 (Δ[gene|C18B886D06879C64B64606371E85A7D4D22DCFAC|glnK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGGCCAGTATATATC, downstream forward: _UP4_ATTCAGAAAGGGTGAACCAA
  • References

  • 10094672,15995196