SubtiBank SubtiBank
slrA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

slrA

negative regulator of the [SW|fla-che operon], anti-repressor, antagonist [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] for the repression of the [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]→[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO] and [gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]-[gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA] operons
locus
BSU_38229
pI
9.00
mw
6.00 kDa
protein length
gene length
159 bp Sequence Blast
function
control of motility and biofilm formation
product
antagonist of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] and [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR]
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.6|Transition state regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.4|Regulation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.4|Swarming]
  • Gene

    Coordinates
    3,923,319 → 3,923,477

    RNA

    additional information

  • the mRNA has long 5' and 3' UTRs (170 and 330 nt, respectively) [pubmed|26857544]
  • The protein

    Catalyzed reaction/ biological activity

  • binding of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] resulting in induction of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]-repressed genes and operons [Pubmed|19788541]
  • Paralogous protein(s)

  • [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI]
  • [SW|Domains]

  • [SW|Sin domain] (aa 1-38) (according to UniProt)
  • Effectors of protein activity

  • [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR] inhibits activity of [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] (i. e. binding to [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]) [Pubmed|19788541]
  • Expression and Regulation

    Operons

    genes
    [gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|YwcC]: repression, [Pubmed|18647168,19788541], in [regulon|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|YwcC regulon]
  • additional information

  • increased expression in a [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant [Pubmed|26857544]
  • half-life of the mRNA: 0.56 min, this increases to 1.06 in a [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant [Pubmed|26857544]
  • RNA degradation by [protein|64C6D783FF3F41C81B216F798A1DC8071345B1ED|PnpA] is proceeds from the 3' end of the mRNA through the [protein|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|Rho]-dependent terminator [Pubmed|26857544]
  • transcription termination depends on [protein|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|Rho] [Pubmed|26857544]
  • view in new tab

    Biological materials

    Mutant

  • BKE38229 (Δ[gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38229 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTAACCTCCAATTGTA, downstream forward: _UP4_TAGTCCGAACAGGCGGATCT
  • BKK38229 (Δ[gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38229 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTAACCTCCAATTGTA, downstream forward: _UP4_TAGTCCGAACAGGCGGATCT
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Stülke] lab
  • References

  • 18647168,19788541,23430750,26857544,22329926