SubtiBank SubtiBank
yitS
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yitS

fatty acid binding protein
locus
BSU_11110
pI
5.63
mw
31.12 kDa
protein length
283 aa Sequence Blast
gene length
852 bp Sequence Blast
function
phosphorylation of fatty acids
product
fatty acid binding protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
  • Gene

    Coordinates
    1,187,700 → 1,188,551

    The protein

    Catalyzed reaction/ biological activity

  • binds and presents fatty acids for phosphorylation to [protein|5DE73E8005AFFD30EB84696B2C2474899C6D1982|FakA] (based on findings for homologous proteins from Staphylococcus aureus) [pubmed|30429218]
  • Paralogous protein(s)

  • [protein|FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF|DegV]
  • [SW|Domains]

  • DegV domain (aa 3-282) (according to UniProt)
  • Structure

  • [PDB|1PZX] (Geobacillus stearothermophilus)
  • Expression and Regulation

    Operons

    genes
    [gene|C13F1870B014F8B2C16D9B169F40747DE5B51B85|yitS]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B196 (yitS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1195 NBRP B. subtilis, Japan]
  • BKE11110 (Δ[gene|C13F1870B014F8B2C16D9B169F40747DE5B51B85|yitS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGCTTCCCTTCTTTC, downstream forward: _UP4_TGAGCAAACAAAAACAGTCA
  • BKK11110 (Δ[gene|C13F1870B014F8B2C16D9B169F40747DE5B51B85|yitS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGCTTCCCTTCTTTC, downstream forward: _UP4_TGAGCAAACAAAAACAGTCA
  • References

    Research papers

  • 30429218