SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


fatty acid binding protein
31.12 kDa
protein length
283 aa Sequence Blast
gene length
852 bp Sequence Blast
phosphorylation of fatty acids
fatty acid binding protein

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of phospholipids]
  • Gene

    1,187,700 → 1,188,551

    The protein

    Catalyzed reaction/ biological activity

  • binds and presents fatty acids for phosphorylation to [protein|5DE73E8005AFFD30EB84696B2C2474899C6D1982|YloV] (based on findings for homologous proteins from Staphylococcus aureus) [pubmed|30429218]
  • Paralogous protein(s)

  • [protein|FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF|DegV]
  • [SW|Domains]

  • DegV domain (aa 3-282) (according to UniProt)
  • Structure

  • [PDB|1PZX] (Geobacillus stearothermophilus)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B196 (yitS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11110 (Δ[gene|C13F1870B014F8B2C16D9B169F40747DE5B51B85|yitS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGCTTCCCTTCTTTC, downstream forward: _UP4_TGAGCAAACAAAAACAGTCA
  • BKK11110 (Δ[gene|C13F1870B014F8B2C16D9B169F40747DE5B51B85|yitS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGCTTCCCTTCTTTC, downstream forward: _UP4_TGAGCAAACAAAAACAGTCA
  • References

    Research papers

  • 30429218