SubtiBank SubtiBank
aseA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

aseA

As(III) efflux pump
locus
BSU_05340
pI
8.97
mw
47.16 kDa
protein length
435 aa Sequence Blast
gene length
1308 bp Sequence Blast
function
resistance to arsenite
product
As(III) efflux pump
essential
no
synonyms
ydfA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • Gene

    Coordinates
    579,889 → 581,196

    The protein

    Protein family

  • ArsB family (with [protein|EB8E3F88BC1ED2BAD5A98D609EDAA002261150A5|YwrK], according to UniProt)
  • Paralogous protein(s)

  • [protein|EB8E3F88BC1ED2BAD5A98D609EDAA002261150A5|YwrK]
  • Expression and Regulation

    Operons

    genes
    [gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]-[gene|C0E921ECAEE12DEC32A5DEE866762D6971360FA1|aseA]-[gene|6BA4A8575050B1BA45FF98E1F3B1F27F6C24A5E4|ydzS/1]-[gene|009BB4460A9374A8259DE7BD05724467198E0A90|ydzS/2]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR]: repression, [Pubmed|15948947], in [regulon|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR regulon]
  • regulation

  • induced by As(III) ([protein|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR]) [Pubmed|15948947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C141 (ydfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2139 NBRP B. subtilis, Japan]
  • BKE05340 (Δ[gene|C0E921ECAEE12DEC32A5DEE866762D6971360FA1|aseA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATGTCAATCTAATGC, downstream forward: _UP4_TAAAAGGACAAGGTCACTAT
  • BKK05340 (Δ[gene|C0E921ECAEE12DEC32A5DEE866762D6971360FA1|aseA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATGTCAATCTAATGC, downstream forward: _UP4_TAAAAGGACAAGGTCACTAT
  • References

  • 15948947