SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


Mg2+-citrate transporter
45.67 kDa
protein length
433 aa Sequence Blast
gene length
1302 bp Sequence Blast
uptake of citrate and magnesium
Mg2+-citrate transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Transporter for organic acids]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Magnesium uptake/ efflux]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    834,383 → 835,684

    Phenotypes of a mutant

  • no growth with citrate as sole carbon source [Pubmed|10972810]
  • The protein

    Protein family

  • [SW|CitM transporter family (TC 2.A.11)] (according to UniProt)
  • Paralogous protein(s)

  • [protein|71A73C825981E74842FC28D1B05CF85E9F3F5A56|CitH]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10972810], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|CitT]: activation, [Pubmed|10972810], in [regulon|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|CitT regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538,10972810], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by citrate ([protein|search|CitT]) [Pubmed|10972810]
  • view in new tab

    Biological materials


  • MGNA-C252 (citM::erm), available at the [ NBRP B. subtilis, Japan]
  • GP2244 (''Δ''''[gene|C0DED68802EF78D2BC16507234AAC3B60D236E68|citM]''::''ermC''), available in [SW|Jörg Stülke]'s lab
  • GP2760 (''Δ''''[gene|C0DED68802EF78D2BC16507234AAC3B60D236E68|citM]''::''kan''), available in [SW|Jörg Stülke]'s lab
  • GP2761 (''Δ''''[gene|C0DED68802EF78D2BC16507234AAC3B60D236E68|citM]''::''spec''), available in [SW|Jörg Stülke]'s lab
  • BKE07610 (Δ[gene|C0DED68802EF78D2BC16507234AAC3B60D236E68|citM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATCCATTCCCCCTTAAA, downstream forward: _UP4_TGATAATTCAGGCGTAATGA
  • BKK07610 (Δ[gene|C0DED68802EF78D2BC16507234AAC3B60D236E68|citM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATCCATTCCCCCTTAAA, downstream forward: _UP4_TGATAATTCAGGCGTAATGA
  • GP2763 (''Δ''''[gene|C0DED68802EF78D2BC16507234AAC3B60D236E68|citM]''::''kan'' ''Δ''''[gene|472E3A2407C83EEE26DB00079D185C4EA2988611|mgtE]''::''spec''), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP2965 (in [SW|pAC6]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP2767 ''citM-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

  • 16842348,11891560,10972810,11053381,3127276,12375105,8892821,12533460,12670692,11029430,12427932,22900538,24415722