SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


mechanosensitive channel, similar to MscS, general stress protein
29.88 kDa
protein length
267 aa Sequence Blast
gene length
804 bp Sequence Blast
resistance to osmotic downshock
anion-selective mechanosensitive channel of small conductance

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.7|Coping with hypo-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,491,221 → 1,492,024

    The protein

    Protein family

  • [SW|MscS (TC 1.A.23) family] (according to UniProt)
  • Structure

  • [PDB|3T9N] (from Thermoanaerobacter tengcongensis, 40% identity) [pubmed|23074248]
  • [SW|Localization]

  • cell membrane [Pubmed|19252899]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials


  • MGNA-B342 (ykuT::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A960 ( ''ykuT''::''cat''), [Pubmed|18310427], available at [ BGSC]
  • BKE14210 (Δ[gene|C0C65835A0E2680F52D391BF4EAB7F463FBB1DD3|ykuT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGAGCTCCTTTTCTA, downstream forward: _UP4_TAAATAAAAGAACCGAAGCT
  • BKK14210 (Δ[gene|C0C65835A0E2680F52D391BF4EAB7F463FBB1DD3|ykuT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGAGCTCCTTTTCTA, downstream forward: _UP4_TAAATAAAAGAACCGAAGCT
  • Labs working on this gene/protein

  • [SW|Erhard Bremer], University of Marburg, Germany [ homepage]
  • References


  • 12626684,22685280,22404681,24607989,17505523
  • Original Publications

  • 17665170,18310427,19252899,11544224,23074248