SubtiBank SubtiBank
phrC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

phrC

response regulator aspartate phosphatase (RapC) regulator / competence and sporulation stimulating factor (CSF)
locus
BSU03780
pI
8.16
mw
4.06 kDa
protein length
gene length
123 bp Sequence Blast
function
control of ComA activity
product
phosphatase (RapC) regulator / competence and sporulation stimulating factor (CSF)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.8|Short peptides]
  • Gene

    Coordinates
    429,963 → 430,085

    The protein

    Catalyzed reaction/ biological activity

  • binds to [protein|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|RapC], this results in the inability of [protein|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|RapC] to interact with [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] [Pubmed|12950917]
  • Protein family

  • phr family (according to Swiss-Prot)
  • Structure

  • [PDB|4GYO] (complex [protein|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|RapJ]-[protein|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|PhrC]) [Pubmed|23526881]
  • Expression and Regulation

    Operons

    genes
    [gene|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|rapC]-[gene|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]
    description
    [Pubmed|10464187]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10464187], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|10464187], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|10464187], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]) [Pubmed|16091051], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
  • view in new tab

    genes
    [gene|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]
    description
    [Pubmed|10464187]

    regulation

  • expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
  • view in new tab

    Biological materials

    Mutant

  • BKE03780 (Δ[gene|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTTAGATTTCAATTTCATA, downstream forward: _UP4_TAAGAACAAGCCCCTTCTCA
  • BKK03780 (Δ[gene|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTTAGATTTCAATTTCATA, downstream forward: _UP4_TAAGAACAAGCCCCTTCTCA
  • References

    Reviews

  • 22024380
  • Original publications

  • 12950917,16816200,19202088,18375560,11267663,10464187,12850135,16091051,23526881,22511326