SubtiBank SubtiBank
yvaK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvaK

general stress protein, carboxylesterase
locus
BSU_33620
pI
4.99
mw
28.26 kDa
protein length
248 aa Sequence Blast
gene length
747 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
3.1.1.1
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,454,221 → 3,454,967

    The protein

    Catalyzed reaction/ biological activity

  • carboxylic ester + H2O --> carboxylate + alcohol + H+ (according to UniProt)
  • Protein family

  • lipase/esterase LIP3/BchO family (single member, according to UniProt)
  • Structure

  • [PDB|1TQH] (Geobacillus stearothermophilus)
  • Expression and Regulation

    Operons

    genes
    [gene|D8851F453E5EF18D36F25834A8CB9C61EAF15E44|secG]-[gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]-[gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]-[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]-[gene|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|ssrA]
    description
    [Pubmed|17369301]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    genes
    [gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]-[gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]-[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]-[gene|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|ssrA]
    description
    [Pubmed|17369301]

    regulation

  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B606 (yvaK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1605 NBRP B. subtilis, Japan]
  • BKE33620 (Δ[gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATGTCTCCCTTTC, downstream forward: _UP4_TGGTAATCAACAGGAGGTCG
  • BKK33620 (Δ[gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATGTCTCCCTTTC, downstream forward: _UP4_TGGTAATCAACAGGAGGTCG
  • References

  • 11544224,17369301,23812333