SubtiBank SubtiBank
yyaJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yyaJ

unknown
locus
BSU40840
pI
9.58
mw
49.51 kDa
protein length
451 aa Sequence Blast
gene length
1356 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,194,389 → 4,195,744

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C09526985A4FFEE49DFBF754FAED845CA86CCC14|yyaJ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B864 (yyaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1863 NBRP B. subtilis, Japan]
  • BKE40840 (Δ[gene|C09526985A4FFEE49DFBF754FAED845CA86CCC14|yyaJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACCCCCTTTTGA, downstream forward: _UP4_TAAAAAAGTCAGTGCGGATC
  • BKK40840 (Δ[gene|C09526985A4FFEE49DFBF754FAED845CA86CCC14|yyaJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACCCCCTTTTGA, downstream forward: _UP4_TAAAAAAGTCAGTGCGGATC