SubtiBank SubtiBank
yxlC
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

yxlC

putative anti-SigY protein
locus
BSU38690
pI
9.49
mw
11.86 kDa
protein length
106 aa Sequence Blast
gene length
318 bp Sequence Blast
function
control of SigY activity
product
putative anti-SigY protein
essential
yes
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,969,999 → 3,970,319

    Phenotypes of a mutant

  • essential [Pubmed|22400495]
  • The protein

    [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|801E92306971E26AD4AB155172B7F4EFDE2F9170|sigY]-[gene|C07156CBA0AA3BAB24D17D15708FC68E74A854A7|yxlC]-[gene|CAADFAFD4C39362D0D0F242C926AE101C683EB5D|yxlD]-[gene|B40D01DDD9EF8B64E46CA7DBF4BAC3DBF8A73986|yxlE]-[gene|D246F61BEAE0D3D6707B4C43A634C02876CC5395|yxlF]-[gene|DCC03844AC58A198B851B564D0A6459C39EBDA2F|yxlG]
    description
    [Pubmed|14769884]

    sigma factors

  • [protein|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY]: sigma factor, [Pubmed|12897008], in [regulon|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B758 (yxlC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1757 NBRP B. subtilis, Japan]
  • BKE38690 (Δ[gene|C07156CBA0AA3BAB24D17D15708FC68E74A854A7|yxlC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTAAATGATCAGAAAGCT, downstream forward: _UP4_GGCGAATGCGAGGTGAAACG
  • BKK38690 (Δ[gene|C07156CBA0AA3BAB24D17D15708FC68E74A854A7|yxlC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTAAATGATCAGAAAGCT, downstream forward: _UP4_GGCGAATGCGAGGTGAAACG
  • References

  • 14993308,12897008,14769884,22400495