SubtiBank SubtiBank
yqaT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqaT

similar to phage-related terminase
locus
BSU_26190
pI
8.27
mw
50.77 kDa
protein length
431 aa Sequence Blast
gene length
1296 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,688,306 → 2,689,601

    The protein

    Structure

  • [PDB|4IFE] (from phage SF6, N-terminal domain, corresponds to aa 2 ... 224) [pubmed|23630261]
  • Biological materials

    Mutant

  • BKE26190 (Δ[gene|C040D37E65E04625F01A1A789E3C3591CDEC66F3|yqaT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTAATCACTGTCATCACC, downstream forward: _UP4_TCAAGACCAGGAAGGAGGTA
  • BKK26190 (Δ[gene|C040D37E65E04625F01A1A789E3C3591CDEC66F3|yqaT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTAATCACTGTCATCACC, downstream forward: _UP4_TCAAGACCAGGAAGGAGGTA
  • References

    Research papers

  • 23630261