SubtiBank SubtiBank
yqaT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqaT

similar to phage-related terminase
locus
BSU26190
pI
8.27
mw
50.77 kDa
protein length
431 aa Sequence Blast
gene length
1296 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,688,306 → 2,689,601

    The protein

    Structure

  • [PDB|4IFE] (from phage SF6, N-terminal domain, corresponds to aa 2 ... 224) [pubmed|23630261]
  • Biological materials

    Mutant

  • BKE26190 (Δ[gene|C040D37E65E04625F01A1A789E3C3591CDEC66F3|yqaT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTAATCACTGTCATCACC, downstream forward: _UP4_TCAAGACCAGGAAGGAGGTA
  • BKK26190 (Δ[gene|C040D37E65E04625F01A1A789E3C3591CDEC66F3|yqaT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTAATCACTGTCATCACC, downstream forward: _UP4_TCAAGACCAGGAAGGAGGTA
  • References

    Research papers

  • 23630261