SubtiBank SubtiBank
yvlA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvlA

unknown
locus
BSU_35130
pI
9.60
mw
11.68 kDa
protein length
108 aa Sequence Blast
gene length
327 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,608,447 → 3,608,773

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C036C00DA07E25F103E65D12C652C12A5DC0B68C|yvlA]-[gene|1443F7E8B8DDA6BDDEFF07E21E64F9D574E0FB1B|yvlB]-[gene|C6976A38AC0631BD5DF1C294DA7497C76D63193C|yvlC]-[gene|B9911180282A2C3DEDEE74CB556F025AF0F26C4E|yvlD]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced by cell wall stress ([protein|search|SigW]) [Pubmed|9987136,12207695]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A380 (yvlA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/380 NBRP B. subtilis, Japan]
  • BKE35130 (Δ[gene|C036C00DA07E25F103E65D12C652C12A5DC0B68C|yvlA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCATTCCACACTCCTA, downstream forward: _UP4_TAAGTAGACAATGGGGAGGA
  • BKK35130 (Δ[gene|C036C00DA07E25F103E65D12C652C12A5DC0B68C|yvlA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCATTCCACACTCCTA, downstream forward: _UP4_TAAGTAGACAATGGGGAGGA
  • References

  • 12076816,20817675,9987136,12207695