SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to gamma-D-glutamyl-L-diamino acid endopeptidase I
43.28 kDa
protein length
376 aa Sequence Blast
gene length
1131 bp Sequence Blast
cell wall metabolism
peptidoglycan hydrolase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Endopeptidases]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • Gene

    2,567,360 → 2,568,490

    The protein

    Catalyzed reaction/ biological activity

  • cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]
  • has both endopeptidase and carboxypeptidase activities [Pubmed|18266855]
  • Protein family

  • peptidase M14 family (single member, according to UniProt)
  • [SW|Cofactors]

  • Zn
  • [SW|Localization]

  • extracellular space (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C480 (yqgT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24830 (Δ[gene|C0192CFF5259B6C9AEB995E5064C2AADF33ED4D3|yqgT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCCCCCTTTTTTGTT, downstream forward: _UP4_TAACTGAAACTTTTTCTTTT
  • BKK24830 (Δ[gene|C0192CFF5259B6C9AEB995E5064C2AADF33ED4D3|yqgT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCCCCCTTTTTTGTT, downstream forward: _UP4_TAACTGAAACTTTTTCTTTT
  • References


  • 18266855
  • Original publications

  • 10708363