SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


phosphoribosylglycinamide formyltransferase 2
41.93 kDa
protein length
384 aa Sequence Blast
gene length
1155 bp Sequence Blast
purine biosynthesis
phosphoribosylglycinamide formyltransferase 2

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    243,892 → 245,046

    The protein

    Catalyzed reaction/ biological activity

  • ATP + formate + N1-(5-phospho-D-ribosyl)glycinamide --> ADP + H+ + N2-formyl-N1-(5-phospho-D-ribosyl)glycinamide + phosphate (according to UniProt)
  • Protein family

  • PurK/PurT family (with [protein|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|PurK], according to UniProt)
  • Paralogous protein(s)

  • [protein|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|PurK]
  • [SW|Domains]

  • [SW|ATP-grasp domain] (aa 111-300) (according to UniProt)
  • Structure

  • [PDB|1KJ9] (with Mg-ATP from ''Escherichia coli'', 55% identity, 69% similarity) [Pubmed|11953435]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7496533], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • BKE02230 (Δ[gene|C00E34EF63B5EAE33CAD5E469893C0A5112B9F35|purT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTGCCCCTCCTATCT, downstream forward: _UP4_TAGAGTTTGAACAGGTCTTG
  • BKK02230 (Δ[gene|C00E34EF63B5EAE33CAD5E469893C0A5112B9F35|purT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTGCCCCTCCTATCT, downstream forward: _UP4_TAGAGTTTGAACAGGTCTTG
  • References

  • 7496533