SubtiBank SubtiBank
hxlA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hxlA

3-hexulose-6-phosphate synthase
locus
BSU_03460
pI
4.56
mw
22.43 kDa
protein length
210 aa Sequence Blast
gene length
633 bp Sequence Blast
function
ribulose monophosphate pathway for formaldehyde fixation
product
3-hexulose-6-phosphate synthase
essential
no
ec
4.1.2.43
synonyms
yckG

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    375,166 → 375,798

    The protein

    Catalyzed reaction/ biological activity

  • D-ribulose 5-phosphate + formaldehyde --> D-arabino-hex-3-ulose 6-phosphate (according to UniProt)
  • Protein family

  • HPS/KGPDC family (single member, according to UniProt)
  • Structure

  • [PDB|3F4W] (from Salmonella typhimurium, 44% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|BF480721B89661BFFE6632BB10C5F4DC29951784|hxlA]-[gene|FB0CEA291CA4EC5FB8410050E61B89EDBA1771F9|hxlB]
    description
    [Pubmed|10572115]

    regulatory mechanism

  • [protein|D9A187961CFB9496A6712E9E48AAD384357A3E1C|HxlR]: activation, [Pubmed|10572115], in [regulon|D9A187961CFB9496A6712E9E48AAD384357A3E1C|HxlR regulon]
  • regulation

  • induction by formaldehyde ([protein|search|HxlR]) [Pubmed|10572115]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C057 (yckG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2055 NBRP B. subtilis, Japan]
  • BKE03460 (Δ[gene|BF480721B89661BFFE6632BB10C5F4DC29951784|hxlA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTGATCCACTCCCTT, downstream forward: _UP4_CTGATTGTCCAAGGATAACT
  • BKK03460 (Δ[gene|BF480721B89661BFFE6632BB10C5F4DC29951784|hxlA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTGATCCACTCCCTT, downstream forward: _UP4_CTGATTGTCCAAGGATAACT
  • References

  • 10572115,16428816,19170879