SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to antibiotic resistance protein
44.59 kDa
protein length
399 aa Sequence Blast
gene length
1200 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,101,166 → 4,102,365

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20185509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (8-fold) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • MGNA-B688 (yxaM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39930 (Δ[gene|BF0E188249161B3CC24D223FDD48B820EBED8F55|yxaM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGGAAAACGAATAAAAGA, downstream forward: _UP4_TAAATGTTTTGTATCACAGT
  • BKK39930 (Δ[gene|BF0E188249161B3CC24D223FDD48B820EBED8F55|yxaM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGGAAAACGAATAAAAGA, downstream forward: _UP4_TAAATGTTTTGTATCACAGT
  • References

  • 10746760,10498721,12618455,15101989