SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to rifampicin phosphotransferase
97.00 kDa
protein length
866 aa Sequence Blast
gene length
2601 bp Sequence Blast
resistance to rifampicin
similar to rifampicin phosphotransferase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    2,051,329 → 2,053,929

    The protein

    Protein family

  • [SW|PEP-utilizing enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7235F9D0048961BBD93FA6A4322018029A607435|YvkC]
  • Structure

  • [PDB|5HV1] (from ''Listeria monocytogenes'', 62% identity) [pubmed|27001859]
  • Additional information

  • The gene is annotated in KEGG and MetaCyc as phosphoenolpyruvate synthase EC In Swiss-Prot the protein is described as “phosphoenolpyruvate synthase”. No literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE18830 (Δ[gene|BF0329D469211F579F5CF0CBB58A6D96DD8CB839|pps]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTACATCTCCCCTTCA, downstream forward: _UP4_TAATGTCTGATGTGTGTAGA
  • BKK18830 (Δ[gene|BF0329D469211F579F5CF0CBB58A6D96DD8CB839|pps]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTACATCTCCCCTTCA, downstream forward: _UP4_TAATGTCTGATGTGTGTAGA
  • References

  • 19935659,20525796,27001859