SubtiBank SubtiBank
pps
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pps

similar to rifampicin phosphotransferase
locus
BSU_18830
pI
5.29
mw
97.00 kDa
protein length
866 aa Sequence Blast
gene length
2601 bp Sequence Blast
function
resistance to rifampicin
product
similar to rifampicin phosphotransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    Coordinates
    2,051,329 → 2,053,929

    The protein

    Protein family

  • [SW|PEP-utilizing enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7235F9D0048961BBD93FA6A4322018029A607435|YvkC]
  • Structure

  • [PDB|5HV1] (from ''Listeria monocytogenes'', 62% identity) [pubmed|27001859]
  • Additional information

  • The gene is annotated in KEGG and MetaCyc as phosphoenolpyruvate synthase EC 2.7.9.2. In Swiss-Prot the protein is described as “phosphoenolpyruvate synthase”. No literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|BF0329D469211F579F5CF0CBB58A6D96DD8CB839|pps]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE18830 (Δ[gene|BF0329D469211F579F5CF0CBB58A6D96DD8CB839|pps]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTACATCTCCCCTTCA, downstream forward: _UP4_TAATGTCTGATGTGTGTAGA
  • BKK18830 (Δ[gene|BF0329D469211F579F5CF0CBB58A6D96DD8CB839|pps]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTACATCTCCCCTTCA, downstream forward: _UP4_TAATGTCTGATGTGTGTAGA
  • References

  • 19935659,20525796,27001859