SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


required for the formation of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair centers
21.83 kDa
protein length
198 aa Sequence Blast
gene length
597 bp Sequence Blast
[category|SW 3.1.5|DNA repair/ recombination]
formation of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair centers

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    28,867 → 29,463

    Phenotypes of a mutant

  • drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
  • The protein

    Catalyzed reaction/ biological activity

  • required for the formation of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair centers (together with [protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO]) [Pubmed|24891441]
  • Protein family

  • RecR family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|TOPRIM domain] (aa 80-175) [Pubmed|9722641]
  • Structure

  • [PDB|2V1C] (the [protein|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|RecR]-[protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO] complex from ''Deinococcus radiodurans'', [protein|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|RecR]: 52% identity, 78% similarity, [protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO]: 30%/ 58%) [Pubmed|17581636]
  • [SW|Localization]

  • cytoplasm (homogeneous) [Pubmed|16479537]
  • Expression and Regulation


    view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • BKE00210 (Δ[gene|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|recR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTTATCCCCCTA, downstream forward: _UP4_TTGTAAGGAGGAAAAAGCGA
  • BKK00210 (Δ[gene|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|recR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTTATCCCCCTA, downstream forward: _UP4_TTGTAAGGAGGAAAAAGCGA
  • References


  • 22933559
  • Original publications

  • 12884008,17581636,16479537,24285298,24285298,24891441,9157236,9108290,8419343,9722641